Journal: Journal of Photochemistry and Photobiology. B, Biology

Article Title: Directly imaging the localisation and photosensitization properties of the pan-mTOR inhibitor, AZD2014, in living cancer cells ☆

doi: 10.1016/j.jphotobiol.2020.112055

Figure Lengend Snippet: mTOR signalling in the cell at a glance. A) Blue filled circles show the mTORC1 protein and pathway, yellow filled circles show mTORC2 and its pathway. Green arrows show activation, red arrows show inhibition. (P) shows phosphorylation (activation). B) Chemical structure of AZD2014. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: AZD2014 and INK128 were purchased from MedChem Express (Europe).

Techniques: Activation Assay, Inhibition, Phospho-proteomics

Journal: Journal of Photochemistry and Photobiology. B, Biology

Article Title: Directly imaging the localisation and photosensitization properties of the pan-mTOR inhibitor, AZD2014, in living cancer cells ☆

doi: 10.1016/j.jphotobiol.2020.112055

Figure Lengend Snippet: Summary of spectroscopic and imaging experimental techniques employed.

Article Snippet: AZD2014 and INK128 were purchased from MedChem Express (Europe).

Techniques: Imaging, Confocal Microscopy, Microscopy, Spectroscopy

Journal: Journal of Photochemistry and Photobiology. B, Biology

Article Title: Directly imaging the localisation and photosensitization properties of the pan-mTOR inhibitor, AZD2014, in living cancer cells ☆

doi: 10.1016/j.jphotobiol.2020.112055

Figure Lengend Snippet: Fluorescence characterisation of AZD2014. A) UV-VIS spectrum of AZD2014 (11 μM) in DMSO solvent. B) Fluorescence spectrum of AZD2014 (7 μM) in DMSO showing excitation profile in black and emission profile in cyan. Spectra shown on two different axis and were taken at different detector settings to provide clean spectrum. C) Excitation spectra of AZD2014 in various solvents (DMSO, PBS and 1 mM BSA/PBS). D) Emission spectra of AZD2014 in various solvents (DMSO, PBS and 1 mM BSA/PBS). E) Fluorescence intensity decays of AZD2014 in various solvents (DMSO, PBS and 1 mM BSA/PBS). F) Summary of lifetimes and quantum yields. Data repeated minimum of three independent times. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: AZD2014 and INK128 were purchased from MedChem Express (Europe).

Techniques: Fluorescence, Solvent

Journal: Journal of Photochemistry and Photobiology. B, Biology

Article Title: Directly imaging the localisation and photosensitization properties of the pan-mTOR inhibitor, AZD2014, in living cancer cells ☆

doi: 10.1016/j.jphotobiol.2020.112055

Figure Lengend Snippet: Live cell uptake and imaging of AZD2014. Confocal imaging of AZD2014 (7 μM) in live A) HEK293 cells, B) CHO cells and C) MCF-7 cells using 405 nm excitation. Scale bar = 10 μm. D) Plot of extracted confocal intensities of AZD2014 (7 μM) over the 17 min with Michaelis–Menten (MM) and non-linear (ExpA) fitting. E) Confocal images of AZD2014 (7 μM) uptake in HEK293 cells taken over 17 min of administration, with one minute time intervals using 405 nm excitation. Scale bar = 50 μm. F) Trypan blue exclusion test of HEK293 cell viability with AZD2014 treatment. Repeated minimum of three independent times. Error bars show standard deviation from three experiments. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: AZD2014 and INK128 were purchased from MedChem Express (Europe).

Techniques: Imaging, Standard Deviation

Journal: Journal of Photochemistry and Photobiology. B, Biology

Article Title: Directly imaging the localisation and photosensitization properties of the pan-mTOR inhibitor, AZD2014, in living cancer cells ☆

doi: 10.1016/j.jphotobiol.2020.112055

Figure Lengend Snippet: Quantification of AZD2014 in live HEK293 cells. A) Two-photon confocal images of AZD2014 in complete growth media (without cells) using 600 nm excitation at 1 mW. B) Calibration line graph of increasing concentrations of AZD2014 in complete growth media (without cells) with extracted intensities using 600 nm excitation. C) Two-photon confocal image of HEK293 cells treated with 7 μM AZD2014. D) Extrapolated nuclear, cytoplasmic and whole cell concentrations in HEK293 cells administered with 7 μM AZD2014. E) FLIM of AZD2014 in HEK293 cells with respected lifetime distributions, colours represent lifetime and not intensity vaues given in D. F) Normalised lifetime distribution plots for cytoplasm and nucleus ( n = 9). Error bars show standard deviation. Scale bar = 10 μm, n > 3.

Article Snippet: AZD2014 and INK128 were purchased from MedChem Express (Europe).

Techniques: Standard Deviation

Journal: Journal of Photochemistry and Photobiology. B, Biology

Article Title: Directly imaging the localisation and photosensitization properties of the pan-mTOR inhibitor, AZD2014, in living cancer cells ☆

doi: 10.1016/j.jphotobiol.2020.112055

Figure Lengend Snippet: Uptake of AZD2014 in 3D multi-layered spheroids. A) AZD2014 (7 μM) administration to HEK293 spheroids imaged using light sheet fluorescence microscopy for 30 min. Images of planes acquired at different xy planes or depths (rows) and at different delays after AZD2014 administration (columns). The bottom row shows the orthogonal projection (xz plane) along the dotted line in the previous row. Images with/without AZD2014 treatment are shown (+/−). Scale bar 150 μm. B) Uptake of AZD2014 fluorescence in the spheroid over 2 h was studied at different depths from the surface. The inset shows the colour coding used for the curves extraction. C) Image planes at 250 μm in depth at different time points from 30 min to 2 h after administration. The blue arrows indicate the direction of increase in spheroid radius. Scale bar 150 μm. D) Mean rates of uptake, determined as the time at half-saturation of the fluorescence, for the various depths are shown. E) Graph showing relative increase of spheroid radius in comparison with the radius at time zero with AZD2014 only (red diagonal fill), 405 nm light only (blue dotted fill) and both AZD2014 and 405 nm (solid gray fill) treatments. Error bars show SD, n > 3. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: AZD2014 and INK128 were purchased from MedChem Express (Europe).

Techniques: Fluorescence, Microscopy, Extraction, Comparison

Journal: Journal of Photochemistry and Photobiology. B, Biology

Article Title: Directly imaging the localisation and photosensitization properties of the pan-mTOR inhibitor, AZD2014, in living cancer cells ☆

doi: 10.1016/j.jphotobiol.2020.112055

Figure Lengend Snippet: PDT of AZD2014 in adherent monolayer cells. A) Compilation of confocal overlay channel (561 nm and transmitted light) images over time and laser power showing cell death (as indicated by red fluorescence staining of PI) in CHO cells following treatment of AZD2014 (7 μM) and then 405 nm (CW) irradiation of FOV shown in cyan blue box (n > 3). B) Images of irradiated CHO cells without drug treatment but irradiated in cyan blue box (n > 3). C) Zoom of control and photoactivated cell death. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Article Snippet: AZD2014 and INK128 were purchased from MedChem Express (Europe).

Techniques: Fluorescence, Staining, Irradiation, Control

Journal: Oncogene

Article Title: Enhanced autocrine FGF19/FGFR4 signaling drives the progression of lung squamous cell carcinoma, which responds to mTOR inhibitor AZD2104

doi: 10.1038/s41388-020-1227-2

Figure Lengend Snippet: a Western blot analysis shows mTOR pathways inhibited by AZD2014. SK-MES-1 cells were stimulated with FGF19 (25 ng/mL) for 20 min with or without pretreatment of AZD2014 (1 μM) for 40 min. b (a) Higher FGF19 and AKT mRNA levels (FGF19: AKT = 1:1) are associated with shorter overall survival, evaluated by Kaplan–Meier Plotter ( http://www.kmplot.com ). (b) Higher FGF19 and lower AKT mRNA levels are associated with longer overall survival. c Representative images (a) and quantitative data (b) of in vivo subcutaneous lung cancer models. FGF19-OE tumors of SK-MES-1cells were re-transplanted subcutaneously, treated with 15 mg/kg (2 days on/5 days off) of AZD2014 or equivalent amount of DMSO vehicle by intragastric administration for 3 weeks. IHC analysis of Ki-67 and p-AKT(S473) expression in tumors (c) with quantitative data (d). d Images of tumor nodules from subcutaneous mouse xenograft model with or without FGF19 overexpression in HCC95 cells treated with AZD2014 or DMSO for 3 weeks in FGF19-OE group from the first week (a) with quantitative data (b). IHC analysis of Ki-67 and p-AKT(S473) expression in tumors (c) with quantitative data (d).

Article Snippet: FGFR4 inhibitor BLU9931 and FGFR pan inhibitor BGJ398 were purchased from Selleck. mTOR inhibitor AZD2014 was kindly offered by AstraZeneca Pharmaceutical Company.

Techniques: Western Blot, In Vivo, Expressing, Over Expression

Journal: Scientific Reports

Article Title: Culture and multiomic analysis of lung cancer patient-derived pleural effusions revealed distinct druggable molecular types

doi: 10.1038/s41598-022-10318-5

Figure Lengend Snippet:

Article Snippet: Vistusertib (AZD2014) , Selleckchem , Cat# S2783 , DMSO , 5.

Techniques: Solvent

Journal: American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons

Article Title: Dual blockade of the PI3K/Akt/mTOR pathway inhibits post-transplant Epstein-Barr virus B cell lymphomas and promotes allograft survival

doi: 10.1111/ajt.15216

Figure Lengend Snippet: (A) Inhibitors (in rectangles) were chosen which block specific nodes in the PI3K/Akt/mTOR pathway. Schematic shows intended targets of CAL-101 (PI3Kδ inhibitor), MK-2206 (Akt inhibitor), rapamycin (mTOR inhibitor), and AZD-2014 (mTORC1/mTORC2 dual inhibitor). (B) Western blot analysis of phosphoproteins (pAKT, pS6K) and total proteins (Akt, S6K, β-actin) in AB5 (EBV+ PTLD cell line) after treatment with rapamycin (100 nM) and with or without CAL-101 (1 µM) and MK-2206 (1 µM), and AZD-2014 (1 µM). β-actin was used as a loading control (representative image from 3 experiments). (C) Western blot of cell lysates from AB5 cultured without or with the indicated inhibitors (rapamycin, CAL-101, MK-2206, and AZD-2014) were probed for activation of alternative signaling pathways (p38 MAPK, p44/42 ERK1/2, and STAT1). β-actin was used as a loading control

Article Snippet: Small molecule inhibitors (rapamycin, CAL-101, MK-2206, AZD-2014) were obtained from Selleck Chemicals (Houston, TX).

Techniques: Blocking Assay, Western Blot, Control, Cell Culture, Activation Assay, Protein-Protein interactions

Journal: American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons

Article Title: Dual blockade of the PI3K/Akt/mTOR pathway inhibits post-transplant Epstein-Barr virus B cell lymphomas and promotes allograft survival

doi: 10.1111/ajt.15216

Figure Lengend Snippet: The EBV-negative Burkitt’s lymphoma line (BL41) and four EBV-positive B cell lymphoma lines from PTLD patients (AB5, MF4, JB7, VB5) were cultured in increasing concentrations of the small molecule inhibitors (A) rapamycin, (B) AZD-2014, (C) CAL-101 and (D) MK-2206 for 72 hours. Cell viability was measured after 72 hours and represented as a percentage relative to control. The error bars represent the SEM of three separate experiments for each condition and cell line. Each experiment was a mean of four technical replicates on the same plate.

Article Snippet: Small molecule inhibitors (rapamycin, CAL-101, MK-2206, AZD-2014) were obtained from Selleck Chemicals (Houston, TX).

Techniques: Cell Culture, Control

Journal: Clinical cancer research : an official journal of the American Association for Cancer Research

Article Title: Diverse resistance mechanisms to the third-generation ALK inhibitor lorlatinib in ALK-rearranged lung cancer

doi: 10.1158/1078-0432.CCR-19-1104

Figure Lengend Snippet: NF2 loss of function mediates resistance to lorlatinib. A, Clinical course of patient MR135 and mutational profile of samples obtained on lorlatinib progression (PD, progressive Disease). B, Cell survival assay assessed with Cell Titer Glo of MR135 lorlatinib resistant cells from biopsy 1 (MR135-R1) treated for 7 days with the indicated concentrations of lorlatinib and vistusertib (AZD2014) alone or in combination. C, Immunoblot analysis from cell lysates of MR135-R1 treated for 24hs with the specified doses of lorlatinib, vistusertib (AZD2014) and ponatinib alone or in combination using indicated antibodies. D, Athymic nude mice bearing MR135-R2 PDX were administered lorlatinib or vistusertib 20 mg/kg orally. Tumor volumes, mean ±SD (n =8); (*** p < 0.001). E, Cell lysates from H3122 parental and H3122 cells with NF2 heterozygous deletions or homozygous deletions, generated by CRISPR-CAS9 gene editing, were immunoblotted to detect merlin expression. H3122 cells with bi-allelic NF2 knock-out lacked merlin expression. F, Cell survival assay of H3122 parental and H3122 NF2 knock-out (NF2 KO) cells treated with lorlatinib for 7 days. Cell survival was assessed by Cell Titer Glo. G, Cell proliferation assay of H3122 parental and H3122 NF2 KO cells untreated and treated with lorlatinib measured at baseline, day 2, day 5 and day 7. Cell viability was assessed with Cell Titer Glo. H, Caspase 3/7 activation (Caspase 3/7-Glo assay) relative to the number of live cells simultaneously assessed in the cell proliferation assay previously described. I, H3122 parental and NF2 KO cells were treated with the indicated doses of lorlatinib for 24hs. Cell lysates were immunoblotted to detect the selected proteins.

Article Snippet: D1203N F- ATGGCGGGGGGAAACCTCAAGTCCTTCC D1203N R- GGAAGGACTTGAGGTTTCCCCCCGCCAT L1196M F- GCCCCGGTTCATCCTGATGGAGCTCATGGCGGG L1196M R- CCCGCCATGAGCTCCATCAGGATGAACCGGGGC Reagents Saracatinib (AZD0530) and vistusertib (AZD2014) were provided by AstraZeneca.

Techniques: Clonogenic Cell Survival Assay, Western Blot, Generated, CRISPR, Expressing, Knock-Out, Proliferation Assay, Activation Assay, Glo Assay

Journal: Cell reports

Article Title: mTOR Overcomes Multiple Metabolic Restrictions to Enable HIV-1 Reverse Transcription and Intracellular Transport

doi: 10.1016/j.celrep.2020.107810

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Where indicated, cells were treated with cytokines or chemokines (Peprotech) at 100 ng/ml, or pretreated with VU0359595 (PLDi) (10, 2, or 0.4 μM, Cayman Chemical), rapamycin (1, 0.2, or 0.04 μM, Cayman Chemical), AZD2014 (mTORi #1) (5, 1, 0.2 μM, Selleckchem), AZD8055 (mTORi #2) (5, 1, 0.2 μM, Selleckchem), TAK-228 (mTORi #3) (5, 1, 0.2 μM, Cayman Chemical), mycophenolic acid (10 μM, Cayman Chemical), or treated with indicated nucleoside (Sigma) at 50 μM at the time of stimulation.

Techniques: Recombinant, ATP Assay, Plasmid Preparation, Expressing, Software

Journal: Oncogene

Article Title: The translational repressor 4E-BP1regulates RRM2 levels and functions as a tumor suppressor in Ewing Sarcoma Tumors

doi: 10.1038/s41388-020-01552-0

Figure Lengend Snippet: Inhibition of mTORC1/2 activates 4E-BP1, blocks protein synthesis, and reduces the level of the RRM2 protein. (A, B, C) Ewing sarcoma cell lines were treated with TAK-228 (1 μM) or temsirolimus (1 μM) for 6 h. Cells were labeled with puromycin to quantify protein synthesis and then lysates were collected for immunoblotting. (D, E) Ewing sarcoma cell lines were treated with AZD2014 (1 μM) for 6 h. Cells were labeled with puromycin to quantify protein synthesis and then lysates were collected for immunoblotting. (F) Sarcoma cell lines were treated with TAK-228 (1 μM) for 6 h. Cells were labeled with puromycin to quantify protein synthesis and then lysates were collected for immunoblotting. (G) EW8 and TC71 cells were treated with TAK-228 (100 nM), AZD1775 (100 nM), or the combination of the drugs for 6 h. (H, I) EW8 and A673 cells were treated for 72 h with a combination of TAK-228 and AZD1775, or TAK-228 in combination with prexasertib. Survival was assayed by Cell-Titer-Glo and each experiment was repeated 2 times. Loewe matrix plots for drug cooperativity are shown. Protein loading for all of the immunoblots was normalized using cell number.

Article Snippet: Chemical compounds were purchased from Sigma (temsirolimus and MG132), Selleckchem (prexasertib, LY2603618, and TAK-228), APExBio (VE-822), Thermo Fisher Scientific (puromycin), and MedChemExpress (AZD1775, homoharringtonine, and AZD2014).

Techniques: Inhibition, Labeling, Western Blot